Indole-3-Acetic Acid Synthesis Essay

Abstract

Auxin is an essential hormone, but its biosynthetic routes in plants have not been fully defined. In this paper, we show that the TRYPTOPHAN AMINOTRANSFERASE OF ARABIDOPSIS (TAA) family of amino transferases converts tryptophan to indole-3-pyruvate (IPA) and that the YUCCA (YUC) family of flavin monooxygenases participates in converting IPA to indole-3-acetic acid, the main auxin in plants. Both the YUCs and the TAAs have been shown to play essential roles in auxin biosynthesis, but it has been suggested that they participate in two independent pathways. Here, we show that all of the taa mutant phenotypes, including defects in shade avoidance, root resistance to ethylene and N-1-naphthylphthalamic acid (NPA), are phenocopied by inactivating YUC genes. On the other hand, we show that the taa mutants in several known auxin mutant backgrounds, including pid and npy1, mimic all of the well-characterized developmental defects caused by combining yuc mutants with the auxin mutants. Furthermore, we show that overexpression of YUC1 partially suppresses the shade avoidance defects of taa1 and the sterile phenotypes of the weak but not the strong taa mutants. In addition, we discovered that the auxin overproduction phenotypes of YUC overexpression lines are dependent on active TAA genes. Our genetic data show that YUC and TAA work in the same pathway and that YUC is downstream of TAA. The yuc mutants accumulate IPA, and the taa mutants are partially IPA-deficient, indicating that TAAs are responsible for converting tryptophan to IPA, whereas YUCs play an important role in converting IPA to indole-3-acetic acid.

Auxin is an essential regulator for various plant developmental processes. Indole-3-acetic acid (IAA), the main auxin in plants, can be synthesized from tryptophan (Trp) -dependent and -independent pathways (1). Several auxin biosynthesis routes have been proposed (Fig. 1A), but none of the proposed pathways in plants have been fully determined (1). In some plant pathogenic bacteria, IAA is synthesized from Trp by the Trp monooxygenase iaaM and the hydrolase iaaH (Fig. 1A). The iaaM converts Trp to indole-3-acetamide (IAM) that is subsequently hydrolyzed to IAA by iaaH (2). Plants also make IAM, but the biosynthesis routes of IAM in plants are not defined (3). IAM can be converted to IAA by Arabidopsis AMIDASE1 (4). Trp can also be converted into indole-3-acetaldoxime (IAOx) by the P450 enzymes CYP79B2 and -B3 (Fig. 1A) (5). The routes from IAOx to IAA are not understood, although both IAM and indole-3-acetonitrile have been suggested as intermediates (Fig. 1A) (3). IAOx is probably not a main auxin biosynthesis intermediate, because (i) a complete elimination of IAOx production in Arabidopsis only leads to subtle growth defects (5), (ii) the enzymes CYP79B2 and -B3 seemed only to exist in a small group of plants, and (iii) there is no detectable IAOx in rice and maize (3).

Fig. 1.

Trp-dependent auxin biosynthesis routes. (A) The proposed pathways for converting Trp to IAA. (B) A complete two-step auxin biosynthesis pathway. IPA, indole-3-pyruvate; TAM, tryptamine; IAOx, indole-3-acetaldoxime; IAM, indole-3-acetamide; IAN, indole-3-acetonitrile; IAAld, indole-3-acetaldehyde; IAA, indole-3-acteic acid. A solid line indicates that a gene has been suggested for the step, whereas no genes have been suggested for the step indicated by a dotted line.

The most important plant auxin biosynthetic enzymes are the YUCCA (YUC) family of flavin-containing monooxygenases (6, 7) and the TRYPTOPHAN AMINOTRANSFERASE OF ARABIDOPSIS (TAA) (8, 9) family of aminotransferases, because inactivating members of either family causes dramatic developmental defects (Fig. 1A). Both families are widely distributed among all sequenced plant genomes. The YUC genes were first identified as auxin biosynthesis enzymes, because overexpression of YUCs leads to auxin overproduction in Arabidopsis (7). YUC genes are essential for embryogenesis, seedling development, vascular patterning, and flower development (6, 10). Furthermore, the yuc phenotypes can be rescued by expressing the iaaM gene under the control of a YUC promoter (6). The TAA genes were independently isolated from three genetic screens. Inactivation of TAA1 leads to altered responses to shade (9), ethylene (8), and the auxin transport inhibitor NPA (11). Furthermore, simultaneously inactivating TAA1 and its close homologs (TAR genes) lead to defects in embryogenesis, vascular patterning, and flower development (8). YUCs were proposed to catalyze the conversion of tryptamine to N-hydroxyl tryptamine, which may be converted to IAOx (7, 12). However, our recent biochemical analysis indicates that YUCs do not play a major role in IAOx production (3). Recent work has also questioned whether YUCs are involved in the tryptamine pathway (13). Flavin monooxygeanses are known to use a broad range of substrates in vitro, because they use the stable C4a-hydroperoxyl flavin, an activated intermediate, for catalysis (14). Therefore, additional genetic and biochemical analyses are needed to define the in vivo roles of YUCs in auxin biosynthesis. The TAA family proteins catalyze the conversion of Trp to indole-3-pyruvate (IPA), but the in vitro data suggest that the reaction from IPA to Trp is actually more favorable (9). Furthermore, the mechanism by which IPA is converted to IAA is still not understood. It has been widely speculated that IPA is converted to indole-3-acetaldehyde (IAAld) by IPA decarboxylase. IAAld then is believed to be converted to IAA by aldehyde oxidases or dehydrogenases (Fig. 1A) (1).

Interestingly, some of the yuc mutant phenotypes are very similar to those phenotypes of taa mutants. For example, yuc1 yuc4 yuc10 yuc11 quadruple mutants fail to make the basal parts of Arabidopsis embryos (10), a phenotype that is also observed in wei8 tar1 tar2-1 (8). Mutant alleles of taa1 are also called wei8 (8), sav3 (9), and tir2 (11), which reflect the three genetic screens that identified the mutant alleles. We keep using the wei8, sav3, and tir2 allele names in this paper so that readers can easily track the alleles of taa1 that are used. A list of mutants used in this work is shown in Table S1. Vascular defects in yuc1 yuc2 yuc4 yuc6 are also very similar to those defects in wei8 tar2-1 (6, 8). Both yuc and wei8 tar2 mutants also have defects in flower development (6, 8). The observed phenotypic similarities between yuc and taa mutants have prompted speculations that YUC and TAA may participate in the same pathway to produce auxin (1, 15). The observation that inactivation of the SPI1/YUC gene in the vt2/taa1 mutant background in maize did not further enhance the phenotypes of vt2 also suggests that the YUC and TAA genes might belong to the same pathway (16).

Although there are many similarities between yuc and taa mutants, there are several key differences. First, the yuc mutants analyzed so far have not been shown to affect shade avoidance responses, whereas taa1/sav3 alone showed dramatic defects in shade avoidance (9). Second, the yuc mutants have not been reported to affect ethylene responses in roots, but taa mutants are insensitive to the inhibitory effects of ethylene in roots (8). Third, the yuc mutants have not been shown to alter responses to NPA in roots, whereas taa is resistant to NPA (11). Fourth, the wei8/sav3 alone dramatically reduced IAA levels in seedlings, whereas quadruple yuc mutants did not show a significant decrease in auxin levels (9), although the yuc mutants have phenotypes much more severe than those phenotypes of wei8 or sav3.

Some of the phenotypic defects observed in yuc mutants have not been observed in taa mutants or have not been analyzed. For example, the floral defects of yuc1 yuc4 seem to be different from those defects in wei8 tar2 mutants (6). The yuc1 yuc4 double mutants have fewer floral organs, whereas wei8 tar2 flowers are defective; however, no floral organs are missing. We have shown that yuc mutants have synergistic interactions with known auxin mutants, including pid, pin1, and npy1 (10, 17, 18). It will be informative to analyze the genetic interactions between the known auxin and taa mutants.

In this paper, we show that all of the phenotypes observed in taa mutants, including root resistance to ethylene treatment, altered shade avoidance responses, and root resistance to NPA treatments, are phenocopied by inactivating certain combinations of YUC genes. We also show that all of the synergistic effects between yuc and known auxin mutants are observed when TAA genes are inactivated in the known auxin mutant backgrounds. Furthermore, we show that overexpression of YUC1 in taa1/sav3 can partially rescue the shade avoidance defects. Overexpression of YUC1 can also rescue the sterile phenotypes of wei8 tar2-2, a weak taa double mutant. However, the characteristic long hypocotyl phenotypes associated with YUC overexpression are not observed in the strong wei8 tar2-1 mutant background. Our genetic analysis put the YUC and TAA genes in the same auxin biosynthesis pathway, with YUCs downstream of TAAs. We discovered that IPA levels in wei tar2 are decreased, whereas in yuc1 yuc2 yuc6, they are increased, further supporting our hypothesis that YUCs function downstream of TAAs. We propose that auxin is synthesized by a two-step pathway in which TAAs convert Trp into IPA and YUCs are responsible for converting IPA into IAA (Fig. 1B).

Results

yuc Mutants Phenocopied the taa Mutants.

Alleles of taa1 were isolated from genetic screens for mutants with altered responses to ethylene (wei8 mutants) (8), shade (sav3 mutants) (9), and NPA (tir2 mutants) (11). Interestingly, no yuc mutants were identified from the three genetic screens. It is likely that genetic redundancy among the YUC genes might have prevented the identification of yuc mutants in the screens.

Our previous work on yuc mutants mainly focused on the development of aerial parts of Arabidopsis (6, 10). We hypothesized that a different set of YUC genes might be responsible for root development. We investigated whether the yuc3, yuc5, yuc7, yuc8, and yuc9 quintuple mutants (yuc Q) displayed resistance to ethylene in roots. The five YUC genes form two distinct clades in the YUC phylogenetic tree (6). As shown in Fig. 2 A and B, the yuc Q mutants were strongly resistant to the treatment of 1-aminocyclopropane-1-carboxylic-acid (ACC), an ethylene biosynthesis precursor. In the presence of 10 μM ACC, root elongation in WT Arabidopsis seedlings was almost completely inhibited (Fig. 2A). In contrast, the yuc Q mutants displayed healthy and elongated roots (Fig. 2A). The ethylene resistance of the yuc Q roots was much stronger than the resistance of wei8 tar2-1 double mutants, which are known to confer ethylene resistance in roots (Fig. 2 A and B). Our data showed that YUC genes also play an important role in root responses to ethylene.

Fig. 2.

Inactivation of YUC genes phenocopied the taa mutants. (A) The yuc3 yuc5 yuc7 yuc8 yuc9 quintuple mutants (yuc Q) displayed strong resistance to ethylene in roots. (B) Measurements of root length. Both wei8 tar2-1 and yuc Q had longer roots in the presence of 10 μM ACC. (C) The yuc1-163 yuc4 double mutants displayed defects in shade avoidance similar to the defects observed in sav3-1/taa1. (D) The yuc Q displayed resistance to the auxin transport inhibitor NPA. Roots of WT plants became swollen, but both wei8 tar2-1 and yuc quintuple mutants had normal root tips. Error bars refer to SD. (Scale bar: 1 mm.)

We previously analyzed shade avoidance responses of the yuc Q mutants, because YUC8 seemed to be induced by shade conditions (9). However, the yuc Q mutants did not show obvious defects in shade avoidance responses under our conditions (9). Our previous experiments had clearly shown that YUC1, YUC2, YUC4, and YUC6 are the predominant YUCs functioning in aerial parts of Arabidopsis (6). Unfortunately, the yuc1 yuc4 double null mutants are completely sterile, making analysis of yuc1 yuc4 in shade avoidance responses unfeasible. We used a weak allele of yuc1 (yuc1-163), which showed vascular and floral defects when combined with yuc4 mutant. The yuc1-163 yuc4 could generate a small amount of seeds that allowed us to analyze the shade avoidance response. As shown in Fig. 2C, under shade conditions, hypocotyls of WT plants were much elongated. In contrast, hypocotyls of sav3-1 were only one-half as long as those hypocotyls of WT plants. The yuc1-163 yuc4 was clearly shade-resistant (Fig. 2C), indicating that YUC genes also participate in shade avoidance responses.

Inactivation of TAA1/TIR2 caused root resistance to the auxin transport inhibitor NPA (11) (Fig. 2D). NPA leads to auxin accumulation in root tips and causes root tip swelling in WT plants (Fig. 2D). We also investigated whether YUC genes play a role in mediating root responses to NPA treatments. Like the taa mutants wei8 tar2-1, the yuc Q mutants did not have a swollen root tip (Fig. 2D), indicating that yuc Q mutants were also resistant to NPA treatments.

Our data showed that the three main characteristic phenotypes associated with taa mutants were also observed in yuc mutants. Interestingly, Arabidopsis plants use the same TAA genes in both the shade avoidance and root responses to ethylene and NPA. By contrast, Arabidopsis uses two different sets of YUC genes for shade avoidance and root responses to ethylene and NPA. YUC1 and YUC4 were the main YUCs used in shade avoidance responses, and Arabidopsis relied primarily on YUC3, YUC5, YUC7, YUC8, and YUC9 for responses to ethylene and NPA in roots.

Characteristic yuc Phenotypes Were Mimicked by Inactivating TAA Genes.

We previously showed that yuc mutants displayed dramatic genetic interactions with known auxin mutants pin1, pid, and npy1 (10, 17, 18). We investigated whether taa mutants could mimic the synergistic genetic interactions observed between yuc and known auxin mutants.

When yuc1 yuc4 was combined with pin1, the development of true leaves in the triple mutants was completely abolished (10). The no-leaf phenotypes could also be observed when yuc1 yuc4 were grown on media containing NPA (10) (Fig. 3A). Clearly, the development of true leaves in both wei8 tar2-1 and wei8 tar2-2 was completely abolished by NPA, whereas under the same conditions, WT seedlings developed true leaves (Fig. 3A). Interestingly, roots of both yuc1 yuc4 and WT plants were swollen (Fig. 3A), whereas wei8 tar2 mutants were resistant to NPA in roots (Figs. 2D and 3A). Our data showed that taa mutants could phenocopy yuc1 yuc4 in terms of the development of true leaves in the presence of NPA (Fig. 3A). The NPA experiments also showed that YUC1 and YUC4 were the main YUCs in regulating the development of aerial parts, but YUC1 and YUC4 were not the main YUCs in root responses to NPA.

Fig. 3.

Mutations in TAA genes could mimic yuc mutants. (A) Inactivation of WEI8 and TAR2 caused the same phenotypes as those of yuc1 yuc4 in aerial parts in the presence of NPA. NPA completely abolished the initiation of true leaves in both taa and yuc mutants (white arrows). Note that yuc1 yuc4 was not resistant to NPA in the root, whereas wei8 tar2 was resistant to NPA in roots (red arrows). (B) The triple mutants of wei8 tar2-1 pid completely deleted cotyledons. (C) Mutations in npy1 enhanced wei8 tar2 mutants. The wei8 tar2 npy1 developed pin-like inflorescences and failed to make flowers. (Scale bar: A and B, 1 mm; C, 1 cm.)

We previously showed that both YUC1 and YUC4 were important for cotyledon development (17, 18). Inactivation of both YUC1 and YUC4 in the pid mutant background leads to a complete deletion of cotyledons (17, 18). When we combined wei8 tar2-1 with pid, the resulting triple mutants also failed to develop any cotyledons (Fig. 3B), showing that both the YUCs and TAAs play similar roles in cotyledon development.

Another well-characterized genetic interaction between yuc and known auxin mutants is the enhancement of yuc1 yuc4 double mutants by npy1 (17). The yuc1 yuc4 npy1 triple mutants completely eliminated the formation of flowers but still developed pin-like inflorescences (17). Simultaneous inactivation of TAA1/WEI8, TAR2, and NPY1 also abolished the formation of flowers (Fig. 3C). The wei8 tar2-2 npy1 developed many pin-like inflorescences (Fig. 3C). Combining the strong mutants wei8 tar2-1 with npy1 led to even stronger phenotypes (Fig. 3C). Both the yuc1 yuc4 npy1 and wei8 tar2 npy1 mutants developed similar pin-like inflorescences, but the wei8 tar2 npy1 had more severe phenotypes. The observed differences could be caused by the fact that additional YUC genes are involved in inflorescences development (6). In fact, the juvenile plants of wei8 tar2-1 were similar to those plants of yuc1 yuc2 yuc4 yuc6 quadruple mutants (6, 8). Our data showed that the taa mutants could mimic all of the yuc phenotypes.

Genetic Interactions Between yuc and taa Mutants.

We directly tested whether there were genetic interactions between yuc and wei8 tar2 mutants. We chose yuc1 yuc4 and wei8 tar2-1, because both double mutants displayed strong developmental phenotypes (6, 8). The yuc1 yuc4 wei8 tar2 quadruple mutants did not make any hypocotyls and roots, a phenotype that was not observed in either yuc1 yuc4 or wei8 tar2-1 (Fig. 4A). Interestingly, the yuc1 yuc4 wei8 tar2 quadruple phenotypes were very similar to those phenotypes of yuc1 yuc4 yuc10 yuc11 and wei8 tar1 tar2-1 (8, 10).

Fig. 4.

Genetic interactions between YUCs and TAAs in Arabidopsis. (A) Synergistic interactions between wei8 tar2-1 and yuc1 yuc4. The yuc1 yuc4 wei8 tar2-1 failed to make hypocotyls and roots. (Scale bar: 2 mm.) (B) Expression of YUC1 cDNA under the control of TAA1 promoter partially rescued the sterile phenotypes of wei8 tar2-2. (Scale bar: 1 cm.) (C) Overexpression of YUC1 cDNA using the 35S promoter partially rescued the shade avoidance defects in sav3-1. Error bars refer to SD. (D) Auxin overproduction phenotypes of 35S::YUC1 are suppressed in wei8 tar2-1 background. (Scale bar: 1 mm.) (E) Overexpression of iaaM in wei8 tar2-1 caused auxin overproduction in both WT and wei8 tar2-1 backgrounds. (Scale bar: 1 mm.) (F) The adult phenotypes of wei8 tar2-1 were also partially suppressed by 35S::iaaM. (Scale bar: 1 cm.)

We expressed YUC1 cDNA under the control of the TAA1 promoter (9) in wei8 tar2-2 background. The wei8 tar2-2 double mutants were weaker than wei8 tar2-1 but still sterile (Fig. 4B). Expression of YUC1 partially rescued the sterile phenotype of wei8 tar2-2 (Fig. 4B).

We also overexpressed YUC1 cDNA using the Cauliflower mosaic virus (CaMV) 35S promoter in the taa1/sav3-1 background. Overexpression of YUC1 in sav3-1 leads to longer hypocotyl, a characteristic phenotype associated with auxin overproduction (6, 7) (Fig. 4C). Overexpression of YUC1 also partially suppressed the shade avoidance phenotypes of sav3-1 (Fig. 4C).

When we introduced 35S::YUC1 construct into wei8 tar2-1 by transforming wei8 tar2-1+/− plants, we did not observe the typical auxin overproduction phenotypes in wei8 tar2-1 plants (Fig. 4D). Because the tar2-1 is a T-DNA line, we investigated whether 35S::YUC1 was silenced in the wei8 tar2-1 background. We found that the expression levels of YUC1 in 35S::YUC1 wei8 tar2-1 were higher than in WT (Fig. S1), suggesting that overproduction of auxin by 35S::YUC1 is dependent on active TAA genes.

YUCs and the iaaM Gene Behaved Differently in wei8 tar2 Mutants.

We previously showed that expression of the bacterial auxin biosynthesis gene iaaM rescued yuc mutant phenotypes (6, 7). Expression of iaaM also rescued the shade avoidance phenotypes of sav3-1 (9). We investigated whether iaaM could rescue the developmental defects of wei8 tar2 mutants. As shown in Fig. 4E, overexpression of iaaM led to the typical auxin overproduction phenotypes in both WT and wei8 tar2 mutants. The iaaM gene also partially rescued the defects of wei8 tar2 phenotypes at juvenile and adult stages (Fig. 4F). Our work shows that YUCs and iaaM genes probably use different mechanisms for auxin biosynthesis.

Both YUCs and TAA Genes Affected the Homeostasis of IPA.

We directly measured the IPA contents in WT plants, yuc mutants, and taa mutants. Because the strong yuc and taa mutants have dramatic developmental defects, we chose yuc1 yuc2 yuc6 triple mutants and wei8 tar2-2 double mutants to analyze the IPA contents. The yuc1 yuc2 yuc6 mutants are similar to wei8 tar2-2. Both the yuc1 yuc2 yuc6 and wei8 tar2-2 are sterile and have similar sizes. As shown in Fig. 5, the IPA levels in wei8 tar2-2 were reduced dramatically. In contrast, the yuc1 yuc2 yuc6 had elevated levels of IPA (Fig. 5). Our data indicate that TAA genes are involved in the production of IPA, whereas YUC genes are involved in metabolism of IPA (Fig. 1B).

Fig. 5.

IPA levels in auxin biosynthesis mutants. Inactivation of yuc1 yuc2 yuc6 caused IPA accumulation, whereas the wei8 tar2-2 mutants had less IPA than WT plants. Error bar refers to SD.

Discussion

Both YUCs and TAAs were reported to participate in Trp-dependent auxin biosynthesis. Here, we have shown that the YUCs and TAAs participate in the same auxin biosynthesis pathway and that YUCs work downstream of TAAs. Our data indicate that TAAs are responsible for making IPA from Trp and that YUCs are required for converting IPA to IAA.

We conclude that YUCs and TAAs participate in the same pathway to convert Trp into IAA. First, inactivation of YUC genes caused the same phenotypes as those phenotypes observed in taa mutants (Fig. 2). Second, all of the yuc phenotypes were mimicked by taa mutants or taa mutant combinations (Fig. 3). The yuc1 yuc4 pid and wei8 tar2-1 pid displayed the exact same no cotyledon phenotypes (Fig. 3). The fact that the yuc and taa mutants had similar phenotypes in every aspect of growth and developmental processes that we have analyzed is indicative that both gene families participate in the same pathway. Alternatively, YUCs and TAAs may participate in parallel auxin biosynthesis pathways. The similar phenotypes observed in yuc and taa mutants could simply be a reflection of decreased auxin levels in the mutants. The latter interpretation is consistent with the observation that yuc1 yuc4 and wei8 tar2 enhanced each other (Fig. 4). However, yuc1 yuc4 mutants are not null for YUC functions because of the existence of other YUCs. The wei8 tar2 mutants are not null for TAA activity either. Therefore, the synergistic genetic interactions between yuc1 yuc4 and wei8 tar2 are also compatible with the interpretation that YUCs and TAAs participate in the same pathway. The hypothesis that YUCs and TAAs are in the same pathway is also supported by the studies on YUC overexpression lines. Overexpression of YUC1 in WT background leads to dramatic auxin overproduction phenotypes (Fig. 4). However, the YUC1 overexpression phenotypes were weakened in the taa1/sav3 background (Fig. 4). We did not observe the long hypocotyl phenotypes associated with YUC1 overexpression in wei8 tar2-1, suggesting that YUC1 overexpression-mediated auxin overproduction is dependent on TAA functions. We were concerned that perhaps hypocotyls of wei8 tar2-1 simply could not elongate. However, when we overexpressed iaaM in wei8 tar2-1, the auxin overproduction phenotypes were clearly observed (Fig. 4).

We place YUCs downstream of TAAs in auxin biosynthesis. We discovered that the taa mutants made less IPA than WT, but yuc mutants accumulated much more IPA (Fig. 5). A logic interpretation is that TAAs make IPA from Trp and that YUCs participate in the conversion of IPA to IAA. This interpretation is also consistent with our findings that overexpression of YUC1 partially rescued the shade avoidance phenotypes of sav3-1 and that expression of YUC1 partially rescued wei8 tar2-2 (Fig. 4). The conversion of the residual IPA in the weak taa mutants was accelerated in YUC overexpression lines, thus making more IAA to partially rescue the weak taa mutant phenotypes.

Although all of the genetic data indicate that YUCs and TAAs participate in the same auxin biosynthetic pathway, we have been puzzled by the fact that yuc mutants did not have lower levels of IAA than WT plants, whereas taa1 alone had a dramatic reduction in IAA levels (8, 9). It is puzzling, because yuc mutants such as yuc1 yuc2 yuc4 yuc6 quadruple mutants had much more severe phenotypes than the phenotypes of taa1/sav3 (6, 8, 10). We hypothesize that the paradoxical results may be partially caused by the nonenzymatic conversion of IPA to IAA during the process of IAA measurement given that yuc mutants accumulate much more IPA (Fig. 5). It is well-known that IPA is very labile in aqueous solutions and that IPA is easily converted to IAA in vitro nonenzymatically (19). It will be necessary to redo the IAA analysis in the yuc mutants by removing IPA first.

It is evident that TAAs convert Trp to IPA by removing the amino group from Trp. However, it is not obvious how YUCs participate in IPA metabolism. We propose that YUCs convert IPA to IAA using a mechanism analogous to the mechanism of lactate monooxygenases, which convert lactate to acetic acid and CO2 (20, 21). Lactate is first converted to pyruvate by transferring the two electrons to the flavin cofactor in lactate monooxygenase. The reduced flavin binds oxygen and subsequently reacts with pyruvate to release CO2 and acetic acid. YUCs probably use NADPH to reduce the flavin cofactor. After the flavin is reduced, the resulting FADH2 can bind oxygen and convert IPA to IAA.

Materials and Methods

The wei8, tar2-1, and tar2-2 mutants were described in ref. 8, and sav3-1 was reported in ref. 9. The npy1 mutant used in this study was the npy1-2 T-DNA allele (SALK-108406) (17). Genotyping of the npy1 mutant has been described (17). The yuc1 and yuc4 mutants were described in ref. 6. The yuc3, yuc5, yuc7, yuc8, and yuc9 quadruple mutants were described in ref. 9. The pid allele was the SALK-049736 line as previously reported (17). Methods for genotyping the various mutants used in this work were described previously (6, 8, 9, 17).

Shade avoidance assay was conducted according to the procedures described previously (9). Ethylene responses were measured using 4-d-old dark-grown seedlings. Root length was measured using the National Institutes of Health image software.

Methods for IPA analysis are shown in SI Methods.

Acknowledgments

We thank members of the Y.Z. laboratory for comments. This work is supported by the National Institutes of Health Grant R01GM68631 (to Y.Z.).

Footnotes

  • Author contributions: Y.Z. designed research; C.W., X.S., K.M., Z.Z., X.D., H.K., and Y.Z. performed research; K.M., X.D., and Y.C. contributed new reagents/analytic tools; C.W., X.S., K.M., Z.Z., X.D., Y.C., H.K., Y.K., J.C., and Y.Z. analyzed data; and Y.Z. wrote the paper.

  • The authors declare no conflict of interest.

  • This article is a PNAS Direct Submission.

  • This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10.1073/pnas.1108436108/-/DCSupplemental.

References

Production of Indole-3-Acetic Acid via the Indole-3-Acetamide Pathway in the Plant-Beneficial Bacterium Pseudomonas chlororaphis O6 Is Inhibited by ZnO Nanoparticles but Enhanced by CuO Nanoparticles

  1. Christian O. Dimkpaa,b,
  2. Jia Zenga,
  3. Joan E. McLeanc,
  4. David W. Britta,
  5. Jixun Zhana and
  6. Anne J. Andersona,b
  1. aDepartment of Biological Engineering, Utah State University, Logan, Utah, USA
  2. bDepartment of Biology, Utah State University, Logan, Utah, USA
  3. cUtah Water Research Laboratory, Utah State University, Logan, Utah, USA

ABSTRACT

The beneficial bacterium Pseudomonas chlororaphis O6 produces indole-3-acetic acid (IAA), a plant growth regulator. However, the pathway involved in IAA production in this bacterium has not been reported. In this paper we describe the involvement of the indole-3-acetamide (IAM) pathway in IAA production in P. chlororaphis O6 and the effects of CuO and ZnO nanoparticles (NPs). Sublethal levels of CuO and ZnO NPs differentially affected the levels of IAA secreted in medium containing tryptophan as the precursor. After 15 h of growth, CuO NP-exposed cells had metabolized more tryptophan than the control and ZnO NP-challenged cells. The CuO NP-treated cells produced higher IAA levels than control cultures lacking NPs. In contrast, ZnO NPs inhibited IAA production. Mixing of CuO and ZnO NPs resulted in an intermediate level of IAA production relative to the levels in the separate CuO and ZnO NP treatments. The effect of CuO NPs on IAA levels could be duplicated by ions at the concentrations released from the NPs. However, ion release did not account for the inhibition caused by the ZnO NPs. The mechanism underlying changes in IAA levels cannot be accounted for by effects on transcript accumulation from genes encoding a tryptophan permease or the IAM hydrolase in 15-h cultures. These findings raise the issue of whether sublethal doses of NPs would modify the beneficial effects of association between plants and bacteria.

Previous SectionNext Section

INTRODUCTION

Negative environmental impacts of chemical crop fertilizers are resulting in the quest for environmentally benign bacterial products with positive impact on plant growth and productivity. One biofertilizer, the phytohormone indole-3-acetic acid (IAA), is important in microbe-microbe and microbe-plant signaling and promotes growth in a variety of plant species (1, 3, 4, 9, 14, 16, 17, 19, 24, 26, 32, 36, 40). However, the plant growth effects of bacterial IAA are concentration dependent: improved cucumber growth in sterile soil correlates with IAA production from Pseudomonas fluorescens CHA0 at <0.7 μg/ml, whereas an overproducing mutant generating IAA at ∼153 μg/ml stunts cucumber growth (4). Canola root growth was increased 35% by a wild-type P. putida strain producing IAA at about 26 μg/ml (32).

IAA is synthesized by plant-associated microbes via tryptophan (trp)-dependent and -independent pathways, and three trp-dependent pathways, namely, the indole-3-acetamide (IAM), indole-3-pyruvate (IPyA), and trp side-chain oxidase pathways, function in pseudomonads (8, 9, 25, 28, 29, 32, 36). Although the plant-beneficial, root-colonizing isolate P. chlororaphis O6 is reported to produce IAA from trp, the pathway was not elucidated (23). Beneficial effects of this microbe, such as increased plant growth and enhanced plant resistance to an array of pathogens and to drought stress, require effective root colonization and the production of secondary products (6, 23, 34, 37).

Nanoparticles (NPs) are generally defined as materials of <100 nm in at least one dimension, possessing unique physicochemical properties such as small size, large surface area, and surface charge and reactivity (35, 42) that differentiate them from bulk particles. Among the NPs, Ag, CuO, and ZnO, used in a variety of industrial, household, and medical products, affect the growth or survival of pathogenic bacteria (2, 20, 42) but also of environmentally beneficial bacteria (2, 10, 11, 18). Previously, we found in short-term cell toxicological studies in water that P. chlororaphis O6 is susceptible to CuO, ZnO, and silver NPs, depending on the dose (10, 11). We are interested in examining the effects of sublethal doses of these NPs on secondary metabolism in beneficial bacteria that produce metabolites that are of environmental importance. Recently, we found that whereas sublethal levels of CuO NPs reduced secreted siderophore levels in P. chlororaphis O6, ZnO NPs increased the production of siderophores (12). Interactions between trp and ZnO NPs are reported to limit the natural fluorescence of the amino acid (21, 27). Such an interaction with NPs in growth medium could affect trp bioavailability to cells and, possibly, its use as a precursor for IAA synthesis in bacteria. Consequently, the objectives of this work were to determine the pathway involved in IAA production and to investigate whether CuO and ZnO NPs affect IAA production in P. chlororaphis O6.

Previous SectionNext Section

MATERIALS AND METHODS

Sources of chemicals.The chemicals used in the study [IAA, IAM, CuO NPs, ZnO NPs, CuCl2, and Zn(NO3)2] were obtained from Sigma-Aldrich. According to information from the manufacturer, the NPs have “as-made” particle sizes of <50 nm for the CuO NPs and <100 nm for ZnO NPs.

Evaluation of metal release from CuO and ZnO NPs in IAA medium.The release of soluble Cu and Zn from CuO NPs (200 mg of Cu/liter) and ZnO NPs (500 mg of Zn/liter), respectively, at 1, 24, and 48 h was measured using suspensions in uninoculated growth medium. This medium (12) contained trp at a final concentration of 200 μg/ml and was at pH 6.8. Soluble metals were assayed by inductively coupled plasma mass spectrometry (ICP-MS) as previously described (11, 12). Additionally, the levels of Cu and Zn ions released in the medium from the NPs in the presence of bacterial cells were determined after 48 h of growth. The cultures were centrifuged twice at 15,500 × g for 30 min to pellet both cells and NPs. The supernatants were then assayed for soluble Cu and Zn by ICP-MS.

Imaging of nanoparticle shape in IAA-inducing medium.Atomic force microscopy (AFM) was used to image CuO and ZnO NPs suspended for 1 h in the growth medium with and without trp. The AFM procedure was performed as previously described (10). At least 5 images were captured for each sample.

Bacterial strain and growth conditions.Suspensions of cells (1 × 108 cells; optical density at 600 nm [OD600] = 0.1) prepared as previously described (12) were added as an inoculum to the medium with or without amendments of CuO NPs (200 mg of Cu/liter), ZnO NPs (500 mg of Zn/liter), Cu ions (3 and 43 mg of Cu/liter from CuCl2), or Zn ions (5 and 20 mg of Zn/liter from Zn[NO3]2) and trp (200 μg/ml). Additionally, the effect of a mix of CuO:ZnO NPs (200:500 mg of Cu:Zn/liter) was evaluated. These NP concentrations were determined previously to be sublethal to P. chlororaphis O6 (11). The Cu and Zn ion concentrations were based on the lowest (after 1 h) to highest (after 48 h) levels of soluble metals released from the NPs. To determine whether trp was essential for IAA production, medium lacking trp was inoculated to compare the results with those from trp-containing medium. To demonstrate the role of IAM as an intermediate in IAA synthesis from trp, IAM (200 μg/ml) was used to replace trp. Cultures were shaken at 150 rpm for 15, 24, and 48 h at 28°C. Culturable cells were identified by plating serial dilutions on LB medium agar and counting the colonies after growth for 2 days at 28°C. All growth assays were performed in triplicate.

Determination of IAM as a pathway for IAA production by P. chlororaphis O6.To determine whether the IAM pathway is involved in IAA production from trp, control cells were harvested after 15 h of growth, and the cell-free supernatants were acidified to pH 2 with 5 N HCl, followed by extraction with an equal volume of ethyl acetate as described previously (23). The ethyl acetate was evaporated by drying and the precipitated residue dissolved in a 1-ml solution containing 25% methanol and 1% acetic acid (pH 4.5). The supernatants from the centrifuged extracts were injected into an Agilent Eclipse Plus C18 reverse-phase column (5 μm; 250 by 4.6 mm) housed in an Agilent 1200 chromatograph. A gradient (10% to 90%) of an acetonitrile-water system containing 0.1% trifluoroacetic acid was programmed over 25 min at a flow rate of 1 ml/min with detection of effluents at 280 nm. IAM as well as IAA in the cultures was quantified by injection of known masses of pure IAM and IAA as standards. Extracts from three separate growth studies were analyzed for each treatment.

The presence of IAM in the trp-fed cultures was further confirmed by means of high-pressure liquid chromatography–mass spectroscopy (HPLC-MS) using an Agilent 1200 high-pressure liquid chromatograph and an Agilent 6220 time of flight mass spectrometer in dual electrospray ionization (ESI) mode, with a mobile phase of (i) 0.1% formic acid–0.1% methanol–double-distilled water (ddH2O) and (ii) 90% Acetonitrile–10% H2O–0.1% formic acid, an injection volume of 20 μl, an Agilent XDB C18 analytical column (4.6-mm inner diameter by 50-mm length, 1.8 μm packing), and a flow rate of 0.350 ml/min. The chromatographic data obtained were processed using the Agilent Masshunter Qualitative application. A qualitative screening for IAM was performed based on selection for the exact masses of the target compounds.

Additionally, IAA production from IAM was examined in 48-h cultures lacking trp but amended with IAM. Both IAM and IAA were detected by thin-layer chromatography (TLC) on plates of silica Gel 60 (EMD Chemicals Inc., Darmstadt, Germany). The plates were loaded with 20 μl of aliquots of the acidified methanol extracts from the culture filtrate and compounds separated in hexane:ethyl acetate:isopropanol:acetic acid (40:20:5:1) for 60 min (7). Following drying, the plates were sprayed with Salkowski's reagent to detect indoles (7). The migration of pure IAM and IAA, applied from solutions at 200 μg/ml, was used as a standard.

Quantification of IAA production by P. chlororaphis O6 in the presence of NPs and ions.To quantify IAA production by P. chlororaphis O6 in the presence of NPs and ions, cell-free supernatants of trp-fed cultures at 48 h were acidified to pH 2 with 5 N HCl and prepared for HPLC as described above. IAA in the cultures was quantified by injection of known masses of pure IAA as a standard. Three separate studies were performed.

Expression from genes encoding trp transport and IAM hydrolase genes in P. chlororaphis O6 cells.Cells harvested at 15 h and 48 h were used as the source of total RNA to examine expression from genes encoding a trp permease and IAM hydrolase. Cells were pelleted by centrifugation and resuspended to an OD600 of 0.1 in water. Total RNA was extracted from the cells by the use of Tri reagent by following the manufacturer's protocols (Molecular Research Center Inc.), and DNA was removed by DNase. The elimination of DNA was checked by using the preparation as a template for PCR with the primers for the iaaH gene. First-strand cDNA synthesis was performed using DNA-free RNA and a commercial kit from Fermentas Life Sciences. The gene-specific primers (generated from gene locus tag Pc02_1549) used for PCR amplification of the trp permease gene were CAGGGAATCGGCAATGTAGT (forward primer) and TGATGAAGCACTACGGCAAG (reverse primer), while those for iaaH (locus tag Pc02_1550) were ATCAAGGCCTGCACGTAGTC (forward primer) and CTGCCGATCTTCGAGTTCTT (reverse primer). These primers were verified for specificity to the respective genes in P. chlororaphis O6 by their use in PCR with genomic DNA and sequencing of the products to confirm the presence of the anticipated sequence. To control for the RNA levels, PCR products were generated from the 16S rRNA gene by the use of GACCGACTACCTGCTCAACG as forward primer and GGCCAGTGGCAGTTCATATT as reverse primer. Conditions used for standard PCR amplification were as follows: initial denaturation at 94°C for 2 min, followed by 30 cycles of denaturation at 94°C for 30 s, annealing at 59°C (62°C for the 16S rRNA gene) for 30 s, and extension at 72°C for 40 s. Final extension was at 72°C for 10 min.

Interaction between CuO/ZnO NPs and trp.The potential physical interaction between CuO/ZnO NPs and trp was examined by measuring the quenching of the intrinsic fluorescence from the amino acid (27) in the uninoculated culture medium. Briefly, the medium containing trp at 200 μg/ml was amended with 200 mg of Cu/liter and 500 mg of Zn/liter as the respective NPs. Suspensions were gently agitated (150 rpm) for 14 h at 25°C, after which aliquots (250 μl) were serially diluted with sterile ddH2O (pH 6.8) and fluorescence was recorded using excitation at 288 nm and emission at 340 nm in a Synergy4 Hybrid Multi-Mode microplate reader (BioTek Inc.). To account for any background fluorescence of the NPs themselves, suspensions of both NPs in the medium in the absence of trp were analyzed similarly. All studies were replicated three times.

Utilization of trp by P. chlororaphis O6 in the presence of CuO and ZnO NPs.The impact of CuO and ZnO NPs on the utilization of trp by P. chlororaphis O6 was examined by HPLC quantification of residual trp in filtered, cell-free culture medium at 15 h of cell growth.

Previous SectionNext Section

RESULTS

Solubility of CuO and ZnO NPs in IAA-inducing medium.Suspensions of CuO and ZnO NPs in the uninoculated medium showed increasing metal release with time from 1 to 24 to 48 h. The solubility of Cu from the CuO NPs was higher than that of Zn from the ZnO NPs. Soluble Cu and Zn in the culture medium after growth of P. chlororaphis O6 for 48 h were at levels similar to those of the uninoculated medium (Table 1). Based on these data, we used ions at 3 and/or 43 mg/liter for Cu and 5 and/or 20 mg/liter for Zn for low and high doses, respectively, in the studies.

Table 1

Release of soluble metal from CuO NPs and ZnO NPs after 1, 24, and 48 h of incubation with gentle agitation in uninoculated trp medium and cell-free supernatants of 48-h-old P. chlororaphis O6 cultures in trp mediuma

Aggregation state of CuO and ZnO NPs in IAA-inducing medium.Aggregation of NPs in suspension is an important phenomenon when considering NP biological activity. AFM imaging of the CuO and ZnO NPs suspended in the medium showed the formation of large aggregates (Fig. 1). For the CuO NPs, particles were mostly round or spherical (Fig. 1A). In contrast, the ZnO NPs suspended in medium were flattened ellipses, with only few rounded particles (Fig. 1B). Thus, the IAA-inducing medium changed the shape of the ZnO NPs but not that of the CuO NPs relative to their original shapes in water suspensions (11). AFM imaging of the medium with or without trp and without NPs lacked any particulates (see Fig. S1A in the supplemental material). To investigate whether trp in the medium was involved in the change in the shape of ZnO NPs, AFM was performed with the ZnO NPs suspended in a medium modified by the omission of trp. This medium also changed the particle shape to a flattened ball, but the particles were shorter in length than in the presence of trp (see Fig. S1B in the supplemental material). Therefore, trp was important for the transformation of the shape of ZnO particles. CuO NPs maintained their rounded shapes in the medium with or without trp (see Fig. S1C in the supplemental material).

Fig 1

Three-dimensional atomic force microscopy images of (A) CuO NPs (200 mg of Cu/liter) and (B) ZnO NPs (500 mg of Zn/liter) suspended in the culture medium. The data shown are typical of multiple images from three different preparations of each sample.

Fluorescence of trp is quenched by CuO and ZnO NPs.The natural fluorescence of trp, with a maximum peak at 340 nm when excited at 288 nm, is reported to be quenched by interactions with ZnO NPs (21, 27). To determine whether such an interaction also occurred in the cell growth medium, the effects of addition of the NPs on trp fluorescence were observed in uninoculated medium. The numbers of relative fluorescence units (RFU) of 104-diluted medium (17,549 ± 522) were reduced to 12,850 ± 1,031 RFU with addition of ZnO NPs (500 mg of Zn/liter), demonstrating a significant (P = 0.05) quenching of trp fluorescence. In contrast, the fluorescence change (15,583 ± 2,284 RFU) observed with CuO NPs (200 mg of Cu/liter) was not significant.

Influence of sublethal doses of NPs on P. chlororaphis O6 growth.Cell growth in the trp medium was at the stationary phase by 24 h, and cell density was maintained at this level (>12 ×1010 cell/ml) at 48 h. The absence or presence of trp had no effect on cell growth (Table 2). The inclusion of NPs and ions delayed growth at 24 h, although cell numbers similar to those of the control were attained at 48 h, with the exception of ZnO NPs amendments, where cell density remained at the 24-h level (Table 2). Similarly, the mixture of CuO and ZnO NPs did not affect P. chlororaphis O6 growth at 48 h, and neither did the replacement of trp with IAM (data not shown). The pH values of the culture supernatants after 48 h were 6.50 (control), 6.26 (CuO NPs), 6.49 (low level of Cu ions), 6.53 (high Cu ions), 6.89 (ZnO NPs), 6.42 (low Zn ions), 6.51 (high Zn ions), and 6.61 (CuO:ZnO mixed NPs). Thus, growth of the P. chlororaphis O6 cells alone slightly acidified the medium, and the metal products had variable effects on the culture pH.

Table 2

Effects of CuO NPs and Cu ions and ZnO NPs and Zn ions on cell culturability (CFU counts) of P. chlororaphis O6a

IAA production from trp in P. chlororaphis O6 and the influence of CuO and ZnO NPs.HPLC showed that IAA eluted separately from IAM, with retention times of 12.5 min and ≤10 min, respectively (Fig. 2). Both compounds were secreted into the medium of 15-h cultures, although IAA abundance at this time was low relative to IAM abundance (Fig. 2). At 48 h, no IAM peaks were detected (see Fig. S2 in the supplemental material). Also, as shown in the inset of Fig. 2, replacement of trp in the medium by IAM mediated the production of IAA, as determined by TLC analysis of 48-h cell-free culture medium. For verification of IAM production from trp, HPLC-MS of the cell-free culture filtrate showed a mass (175.08 m/z) that agreed with the mass obtained with pure IAM.

Fig 2

Representative HPLC spectra of pure IAA and IAM and of 15-h P. chlororaphis O6 (PcO6) cell cultures, indicating the presence of IAM as an intermediate of IAA production in the presence of trp. Inset: a representative TLC-based assay for direct IAA production via IAM by 48-h cultures of P. chlororaphis O6 cells grown with IAM but without trp. Pure IAA and IAM were coloaded to verify conversion of IAM to IAA.

The production of IAA was further confirmed by HPLC in 48-h stationary-phase cultures. IAA accumulated in these cultures at a level of about 30 μg/ml but only when trp was provided (Fig. 3). Amendment of the medium with CuO and ZnO NPs modified IAA levels from those of the control cultures. The data in Fig. 3 from 48-h culture medium show that a significant (P = 0.05) increase in IAA production was observed with CuO NPs (∼34% above control) and at the high Cu ion dose (43 mg of Cu/liter); no change in IAA levels was caused by the Cu ion at 3 mg/liter. In contrast, ZnO NPs reduced IAA levels by 79% from the control value, but Zn ions at 5 mg/liter and 20 mg/liter did not reduce IAA levels from the control levels. The extent of inhibition of IAA formation caused by the ZnO NPs was reduced by coaddition of CuO NPs; in cultures with the mixed NPs, the IAA level was closer (21.7 ± 3.4 μg/ml) to that of cells treated with the CuO NPs alone.

Fig 3

Detection of the production of IAA in 48-h-old P. chlororaphis O6 cells and the effects of amendment with CuO NPs (200 mg of Cu/liter), Cu ions (3 and 43 mg of Cu/liter), ZnO NPs (500 mg of Zn/liter), and Zn ions (5 and 20 mg of Zn/liter) on trp-dependent IAA production. Data represent means and standard deviations (SDs) of the results of three replicate studies; different letters on bars indicate significant differences among the treatments (P = 0.05).

Metabolism of trp by P. chlororaphis O6 in the presence of CuO and ZnO NPs.An effect of the NPs on the utilization of trp was also observed. A representative chromatogram (not shown) of replicated HPLC analysis of trp levels in 15-h cultures indicated that trp was used to a greater extent in the cultures amended with CuO NPs than in those amended with ZnO NPs. Trp levels (1,300 mass absorbance units [mAU]) in the control cultures were reduced to 1,000 mAU (23% decrease) in the presence of CuO NPs but were unaffected by ZnO NPs. These findings correlated with the stimulation in IAA production by CuO NPs and inhibition by ZnO NPs. Enhanced conversion of trp to the intermediate (IAM) in the presence of CuO NPs was also demonstrated by HLPC-MS analysis of 15-h culture medium for a mass of 175.08 m/z, which is characteristic of the IAM molecule. Whereas IAM was detected at 60 ± 10 ng/ml with the control culture, there was an approximately 53% increase (92 ± 29 ng/ml) for cultures with CuO NPs and an approximately 43% reduction (34 ± 9 ng/ml) with ZnO NPs.

CuO and ZnO NPs do not influence expression of trp transport and IAM hydrolase genes.An operon encoding genes involved in IAM-dependent IAA synthesis is present in the P. chlororaphis O6 genome. The operon contains genes iaaM (for a trp transporter, encoding the trp monoxygenase that produces IAM) and iaaH, which converts IAM to IAA. No genes encoding indole-3-pyruvate decarboxylase and IAAld dehydrogenase, for the alternative IAA pathways in pseudomonads (29, 32), were found in this genome. Transcript accumulation from a gene encoding trp transport and iaaH was detected in RNA isolated at 15 h (Fig. 4); no transcripts from these genes were detected in cells from 48-h cultures, although product was generated for the 16S rRNA genes (see Fig. S3 in the supplemental material). There was no effect of CuO NPs or ZnO NPs or of low doses of Cu and Zn ions on the levels of transcription observed in the cells from the 15-h cultures. The finding of no iaaH gene expression at 48 h correlated with the lack of IAM in the HPLC of 48-h cultures (see Fig. S2 in the supplemental material).

Fig 4

Gel images of reverse transcription-PCR (RT-PCR) bands from cDNA derived from RNA containing transcripts from the 16S rRNA genes and the genes encoding trp transport and IAA hydrolase (iaaH) extracted from cells of 15-h cultures. Culture treatments (control [C], CuO NPs at 200 mg of Cu/liter, Cu ions at 3 mg of Cu/liter, ZnO NPs at 500 mg of Zn/liter, or Zn ions at 5 mg of Zn/liter) did not affect the levels of gene transcripts accumulated at 15 h. Data shown are representative of the results of at least two replicate studies.

Previous SectionNext Section

DISCUSSION

We established the involvement of the IAM pathway for IAA production in the plant growth-promoting rhizobacterium P. chlororaphis O6. Previously, this pathway has been associated only with streptomycetes and the plant-pathogenic pseudomonads P. savastanoi and P. syringae (25, 28, 32, 36). The conversion of trp to the intermediate IAM, and IAM to IAA, was demonstrated with P. chlororaphis O6 cells. Culture age markedly affected expression of the studied genes for IAA biosynthesis. Expression from genes encoding a trp permease and iaaH, present within an operon in the P. chlororaphis O6 genome, was detected only in log-phase (15-h) cell cultures but not in stationary-phase (48-h) cell cultures. These findings correlated with the presence of IAM in 15-h but not 48-h cultures, although IAA was detected in the later cultures.

Modifications to IAA produced in P. chlororaphis O6 by the IAM pathway occurred in the presence of CuO and ZnO NPs. The IAA levels produced by P. chlororaphis O6 with the various treatments (5 to 37 μg/ml) were in the region that would boost rather than inhibit growth (3, 4, 24, 32). The levels of Cu and Zn from the NPs used in testing the soil bacterium were relevant to levels reported for contaminated soils, ranging from 100 mg/kg to 1,000 mg/kg of Cu and 2,000 mg/kg of Zn; normal soils contain between 22 and 68 mg/kg Cu and 92 and 180 mg/kg Zn (14, 33, 38, 39, 41). At 200 mg of Cu/liter, the CuO NPs increased the conversion of trp to IAM in 15-h cultures and resulted in higher IAA levels in the culture medium by 48 h than in control cultures. In contrast, the presence of ZnO NPs at 500 mg Zn/liter lowered the levels of IAM at 15 h and of IAA in the culture medium at 48 h compared with controls. The stimulation of IAA production by CuO NPs correlated with the levels of ion release from the NPs. Amendment of the growth medium with Cu ions equivalent to release from CuO NPs in the cell-free medium at 48 h significantly increased IAA levels. In contrast, the inhibition of IAA production by the ZnO NPs was not correlated to Zn solubilization; IAA levels were not decreased by Zn ion amendments. Thus, although both NPs provided a continual source of soluble metal at rates that are sublethal to P. chlororaphis O6 cells, the released ions acted differently on IAA production in these cells.

The effects of ions on P. chlororaphis O6 differed from the inhibition in IAA production observed in other microbes where Cu ions, as well as Al, Cd, Fe, Ni, and Pb ions, inhibited IAA production (5, 13, 15, 22). For instance, Cu ions at 25 mg/liter reduced IAA production in different Streptomyces species (15) and in Azospirillum brasilense at 32 mg/liter (22). In plant studies, physical interaction between IAA and metals was previously proposed to form complexes that decreased the amount of free IAA (30). We investigated this possibility by incubating ZnO or CuO NPs with a known concentration of pure IAA for 48 h. However, we found no reduction of IAA levels in the presence of either of the NPs based on the Salkowski's universal assay for IAA quantification (data not shown). Thus, we cannot explain the reduction of IAA by ZnO NPs due to complexation between IAA and the ZnO NPs. Oberhänsli and coworkers (29) demonstrated that P. fluorescens CHA0 produced more IAA as the culture pH increased from 5.5 to 7, whereas P. fluorescens CHA750 showed an opposite effect. Therefore, based on the pH values of the P. chlororaphis O6 cell cultures after 48 h for control, CuO NP, and ZnO NP challenges, a role for pH in the responses to CuO and ZnO NPs cannot be ruled out.

We demonstrated quenching of trp fluorescence by ZnO NPs in the growth medium, agreeing with the report of Mandal et al. (27), whose work was based on water suspensions. Quenching of trp fluorescence by ZnO NPs was proposed to involve the Van der Waals and hydrogen bonding forces (21, 27). The ZnO NPs used by Mandal et al. (27) were mainly round in the water suspension, whereas our ZnO NPs in water suspension were angular (11). Thus, we posit that NP shape was not important for quenching. However, we observed a remarkable transformation in the particle sizes and shapes of the ZnO NPs in suspension in the growth medium. The particles agglomerated to micron sizes that differed in shape whether or not trp was present. Trp fluorescence was not changed by CuO NPs, and no major modifications in particle size or shape were observed from this association. Particle shape is suggested to be involved in NP biological activity (31). Here, round CuO NPs enhanced bacterial IAA production whereas IAA production was reduced in the presence of ZnO NPs that had modified to elongated structures in the growth medium. Further studies are necessary to clarify whether the observed changes in NP bioactivity was dependent on their shapes in the growth medium.

Changes in IAA production represent the second observation of altered bacterial secondary metabolism induced by sublethal levels of CuO and ZnO NPs. Previously, we reported in a study of P. chlororaphis O6 that CuO NPs inhibited but ZnO NPs stimulated the production of the fluorescent siderophore pyoverdine; siderophores are involved in plant growth promotion (see reference 12 and references therein). The inhibitory effect of the CuO NPs on pyoverdine production was not explained by Cu ion release but by reduced expression of the gene responsible for the secretion of immature pyoverdine into the periplasm (12). In the present study, no evidence of differential expression for the genes encoding trp permease and IaaH in the presence and absence of the CuO and ZnO NPs in P. chlororaphis O6 was found. Unfortunately, the genes involved in the secretion of bacterial IAA from cell membranes are not known (36); thus, the effects of the NPs on expression of genes involved in IAA release in P. chlororaphis O6 remain unknown. The contrasting effects of CuO and ZnO NPs on different bacterial metabolites (siderophores versus IAA) suggested that there is not a generalized effect of NPs on secondary metabolite production in this microbe.

In summary, we have demonstrated that CuO and ZnO NPs differentially modified IAA production in vitro in the soil isolate P. chlororaphis O6. It remains to be seen whether NPs influence IAA production and activity when P. chlororaphis O6 is colonizing plant roots. Increased IAA production with exposure to CuO NPs can be explained by ion release, while the inhibitory effect of the ZnO NPs was nanospecific. The increasing manufacture and use of products containing different types of NPs means that environmental contamination is inevitable. Our studies demonstrated that NPs at sublethal levels differentially alter both IAA and siderophore production in a soil bacterium. Thus, it is difficult to predict whether beneficial effects of root colonizers such as P. chlororaphis O6 will be compromised by contaminating NPs. Studies to determine the outcome of plant-P. chlororaphis O6 interactions in the presence of CuO and ZnO NPs are under way.

Previous SectionNext Section

ACKNOWLEDGMENTS

This work was supported by the USDA-CSREES (grant 2009-35603-05037), the Utah Agricultural Experiment Station (Journal Paper 8302), and the Utah Water Research Laboratory.

We appreciate the laboratory assistance provided by Moon-Juin Ngooi.

REFERENCES

  1. 1.↵
  2. 2.↵
  3. 3.↵
  4. 4.↵
  5. 5.↵
  6. 6.↵
  7. 7.↵
  8. 8.↵
  9. 9.↵
  10. 10.↵
  11. 11.↵
  12. 12.↵
  13. 13.↵
  14. 14.↵
  15. 15.↵
  16. 16.↵
  17. 17.↵

0 comments

Leave a Reply

Your email address will not be published. Required fields are marked *